Remember that when you’re hired during a bad market, your salary will be lower than usual, which sets up many years of being underpaid, in a compound manner if you stay with the same company. It may actually be more profitable to wait out the market.

Proof of snake

When ai start using bitcoin wallets en masse it’ll be pretty easy for some teenager’s basement clawbot to bribe military ai won’t it 🌝

Rage bait puts me to sleep

Twitter is noise

if ordinals and nft pfps gain in popularity again and then have staying power I really wonder which will be at the top long term and how many total collections will matter. Eth only has like 3 desirable collections. So we’re talking current demand is for about 30k single pfps. We know many flipper-holders have 10+, so let’s shrink the current real demand by individuals that only want one “forever” pfp by 10x. With a 10x growth in crypto usage, that means the number of 10k pfps that can service most individual’s demand for one should be between 3 and 30, roughly. This means there’s room for a few ordinals top tiers, imo. And of course especially if eth price tanks despite usage and then finally dies alongside all other fiats. With increased adoption you should get different niche communities and use case demand, but this is how I think about buying pfps broadly. As a super lightweight collector it’s just a reminder to keep pfps to a minimum and only got after top projects (and of course the ones you love regardless of popularity).

first there is a mountain, then there is no mountain, then there is

#nodesy nom de plume is derived from satoshi's genesis block timestamp ending in "banks" and another field adding "ÿÿÿÿ" after it because we’re replacing the banks yall

Shit I didn’t know plebstr was already being used lol

I will buy art on ordinals I really like but most things are priced quite high when you compare to a physical copy. Cool ordinals artworks are usually about $50-300 which is pretty common for a physical art print. The difference is usually there's at most 500 physical prints available whereas with ordinals these artists are making 10,000 copies. Sure, they are technically 1 of 1s but each is made programmatically, so IMHO they are basically low effort print copies. The price stays high because only 1-10% are listed. In contrast, true 1 of 1s are usually reasonably comparable to physical originals, in the low thousands. Anyway, my point is I think 10,000 collections are overpriced by a factor of about 100 so watch out.

Nostr only for real

Dumping some pfps, only need one or two practically, would rather collect non pfp art

People love spiderman but hate spiders they are hypocrites

Hidden genometries. Non-human intelligence may have artificially evolved homo sapiens. In this scenario it is possible that secret "engineering signatures" may exist in the human genome. Meanwhile, the NHI realm appears recalcitrant to traditional scientific inquiry and may require non-scientific approaches to discovery. Here, I used Ai to identify curious mathematical anomalies in human DNA that may contain hints about the "engineering signatures" of non-human intelligence. Various math transformations were applied to the human genome to identify DNA sequences with interesting "metadata" patterns and subsequently visualized. #art #artstr #nhi

What little I follow of this minute’s culture wars— it seems like the options now are 1) suffocating ultra traditional lifestyles or 2) bottom of the barrel abject nihilism. I feel sorry for the younger generations walking their youthful energy right into this wall but man I feel lucky to have lived my early adulthood when the hopeful theatre kids were gaining control (they’ve gone too far imho but that’s beside the general point here). Going to continue to try to keep the art and freedom and low judgement vibes of that time alive in my own personal life and bring it out in others where I can.

If you believe in the “bitcoin changes you” part of the saying, it’s good that governments and corporations and money printers and criminals are dipping their greasy little fingers in rn.

Pepedase. In bacteria, the enzyme Peptidase E (PepE) is encoded by the gene PEPE. Pepedase is an atomic view of the PepE enzyme’s spatial architecture based on publicly available scientific data. I visually arranged the perspective and coloring to pay homage to Pepe the Frog, a major character in early bitcoin art experimentation. The creator of Pepe, Matt Furie, launched the SavePepe movement which sought to produce positive derivative works of Pepe. While this movement had its height long before I became aware of it, I made this piece (and Pepegene, below) in the same spirit. Pepegene. Genes in living organisms are subject to mutation across time. In contrast, information on the bitcoin ledger is immutable. By etching the pepE DNA sequence onto NOSTR, its ability to evolve is lost. This challenges the significance of genetic information in a foreign digital context. I chose to keep the title “PEPEGENE” in upper case on the inscription as a homage to the naming convention for Counterparty assets. This additionally contrasts the notation of a digital asset identifier (PEPEGENE) against the notation of biological identifiers (a,t,c or g), which are kept in lower case. PEPEGENEatggaactgcttttattgagtaactcgacgctgccgggtaaagcctggctggaacatgcactgccgctaattgctgaacagttgcagggtcgccgctcagcggtgtttatccctttcgctggcgtaacgcagacctgggatgattacacagcgaaaacggctgcggttctcgctccgctgggtgtttctgtcaccggtattcatagcgttgtcgatcccgttgccgcgattgaaaatgctgagatcgtgattgtcggcggcgggaatactttccagttgctgaaacagtgccgcgagcgcgggctgctggcaccaattactgacgtggttaaacgtggcgctctgtatattggctggagcgcaggcgctaaccttgcttgcccaactattcgtaccaccaacgatatgccgattgtcgatccgcaaggtttcgatgcgctaaatctgttcccgctgcaaatcaacccgcacttcaccaacgcgctgccggaaggccataaaggtgaaacccgtgagcagcgtattcgcgaactgctggtcgtcgcgccagaactgacgattattggtctaccggaaggtaactggatcacagtgagtaaaggtcacgctacgctgggtggcccgaacaccacttatgtgtttaaggctggtgaagaagcggttccgctggaagctggtcaccgtttttaa

USD lending and yield on bitcoin is shitcoining never forget. The stock market and real estate is also mispriced and part of shitcoin games with people rewriting the rules on inflatable tokens just like Vitalik never forget 🤙