jb55's avatar
jb55
_@jb55.com
npub1xtsc...kk5s
I made damus, npubs, and zaps ⚡️ Independent bitcoin core and lightning dev.
jb55's avatar
jb55 2 months ago
Todays book haul image
jb55's avatar
jb55 2 months ago
just for fun i wrote some code that encode and decodes messages in this format, which a non-computer-science person claimed to have received by aliens while they were sleeping image what's interesting about this code: it's not binary, its quaternary. its composed of 4 different symbols in a way that lets you encode 3 different messages simultaneously, its a kind of multiplexed code. already that was kind of curious to me. if someone did make this up its pretty clever and I've never seen this type of steganography before: ■┃│□│□□┃■┃│■┃│□┃■│┃■┃│□│□┃│■┃□□│□│┃□┃┃│■□┃┃□□│□┃■│┃■┃│┃□■┃││□┃□■■■┃■□■□□■┃┃│□┃□■■││■┃■□■■┃┃│■■│■■┃□■■│■│□┃┃■□■□│■┃│┃■┃□□■□│■□■■■□┃┃┃■□┃┃■┃│□││┃│■┃┃□┃││┃■│┃■┃┃┃□■■│□■□■□■│┃│■┃■┃□│┃│■■□■■││■┃┃││■┃┃□│┃┃■■■┃□■□■□■┃┃□■┃■│□││■■■□┃■││┃■■┃■■││┃■┃□□□│┃■│□□□■┃││□□│┃■■┃■■□■□□││□┃│■■□││■■┃□┃□││■□□□┃■││■□┃□■□┃│■ another interesting thing about 4-symbol codes is that it can be encoded as DNA: ATGCGCCTATGATGCTAGTATGCGCTGATCCGCGTCTTGACTTCCGCTAGTATGTCATGGCTCAAATACACCATTGCTCAAGGATACAATTGAAGAATCAAGAGCTTACACGATGTATCCACGACAAACTTTACTTATGCGGTGATTCTGGTAGTATTTCAAGCACACAGTGATATCGTGAACAAGGATTGGATTCGTTAAATCACACATTCATAGCGGAAACTAGGTAATAAGGTATCCCGTAGCCCATGGCCGTAATAACACCGGCTGAACGGAATCTCGGACCCTAGGACTCACTGA DNA has been theorized as a very efficient way to store information at very small scales. the multiplexed message decodes to: > imminent thrEat soon upon earths lead > royal EMERTHER warn > eMbRace this vess this is probably a hoax, but reverse engineering the encoding was pretty fun.
jb55's avatar
jb55 2 months ago
with the increase of code being generated by ai, we can learn from the linux kernel on how to manage thousands of patches per day. the kernel has maintainers that test and cherry pick hundreds of patches into their "ready to merge" branch. I have been doing this with @elsat's vibed patches. the idea is to clean up the patches, test them, and cherry pick them onto my staging/integration branch. I then pass it off to our iOS maintainer so that he doesn't have to vet or test 100s of these small changes. here's an example: View quoted note →
jb55's avatar
jb55 2 months ago
Just saw this in the bitcoin development fund signal chat 30m ago from Ziya Sadr (iranian bitcoiner): > just in case if you're wondering about what's the situation in Iran > there's millions of people on the street in every city in Iran > It's the most heroic scene and the closest we Iranians have been to overthrowing the regime hundreds of people have been shot and killed by the Iranian regime, It's a total warzone. People empty handed, the regime with shotguns, AK47, etc.. > The internet is completely shut down since 2 hrs ago. > People are unified in what they want and all chant together "This is the final battle" and they just want to take the regime down. They have decided and chant on their next leader as Reza Pahlavi. > If you care about this, it would be great if you can just tell others around you about what's going on in Iran or repost sth on twitter to your audience about the Iranian people who are completely in the dark right now and nobody knows about their battle.